Splice variants DNMT3B4 and DNMT3B7 overexpression inhibit cell proliferation in 293A cell line

Guo Shao & Ran Zhang & Shu Zhang & Shuyuan Jiang & You Liu & Wei Zhang & Yanbo Zhang & Jinping Li & Keri Gong & Xin-Rong Hu & Shi-Wen Jiang

Abstract

DNA methyltransferase 3B (DNMT3B) is critical in abnormal DNA methylation patterns in cancer cells. Nearly 40 alternatively spliced variants of DNMT3B have been reported. DNMT3B4 and DNMT3B7 are two kinds of splice variants of DNMT3B lacking the conserved methyltransferase motif. In this study, the effect of inactivation of DNMT3B variants, DNMT3B4 and DNMT3B7, on cell proliferation was assessed. pCMV-DNMT3B4 and pCMV-DNMT3B7 recombinant plasmids were developed and stably transfected into 293A cells. 293A cells transfected with plasmid pCMVDNMT3B4 or pCMV-2B were then treated with G418 to the stable cell lines. After that, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide method was used for testing the proliferation level, and flow cytometry was used to test cell cycle distribution of the cell line. The expression of p21 was detected by real-time PCR and Western blot. The methylation status of p21 promoter was detected by methylation-specific PCR (MS-PCR). It was found that DNMT3B4 and DNMT3B7 overexpression could inhibit cell proliferation and increase the expression of p21. Cell cycle analysis demonstrated that inactivation of DNMT3B variants overexpression inhibited cell cycle progression. Inactivation of DNMT3B variants overexpression facilitated p21 expression to delay 293A cell proliferation. These findings indicate that inactivation of DNMT3B variants might play an important role in cell proliferation correlating with the change of p21.

Keywords DNA methyltransferase 3B . 293A cell . Cell proliferation . p21

Introduction

DNA methylation is a well-known epigenetic affair, which takes place at the 5-C position of the cytosine residues at CpG dinucleotides catalyzed by DNA methyltransferase (DNMT). There are three DNMTs to execute genomic methylation pattern. DNMT1, keeping DNA methylation patterns after DNA replication, is the predominant maintenance DNMT and preferentially recognizes hemimethylated DNA. DNMT3A and DNMT3B, establishing the new DNA methylation patterns, are critical for de novo DNA methylation during embryogenesis and germ cell development (Shen et al. 2010). The DNMTs (DNMT1, DNMT3A, and DNMT3B), together with a noncatalytic accessory DNMT3L, establish specific DNA methylation patterns in the genome during gametogenesis, embryogenesis, and somatic tissue development.
Cancer cells have an abnormal pattern of DNA methylation andaberrantexpressionofDNMTs.Significantoverexpressionof DNMT3B was seen in tumors, while DNMT1 and DNMT3A were only modestly overexpressed and with lower frequency (Robertsonetal.1999).AninterestingphenomenonofDNMT3B wasthefindingofmultiplealternativelysplicedforms.DNMT3B has nearly 40 known splice variants expressed in a tissue- and disease-specific manner, but roles of these splice variants are still unclear in modulating DNMT3B function (Gopalakrishnan et al. 2009). Different forms of the same enzyme, for example, DNMT3B splice variants, may have enhanced or reduced enzymatic activity or may have different favorite sequences (Kumar et al. 1994). DNMT3B splice variants may be divided into two groups, with or without DNA methyltransferase activity (Saito et al. 2002). DNMT3B4 and DNMT3B7, without conserved methyltransferase motifs IX and X, probably lack DNA methyltransferase activity (Saito et al. 2002; Shah et al. 2010). Ostler et al. (2007) suggested that the abnormal patterns of DNA methylation present in nearly all cancer cells may be regulated in part by the presence of catalytically inactive DNMT3B proteins. The overexpression of DNMT3B4 and DNMT3B7 within the 293 cell line led to alteration in the DNA methylation state and corresponding gene expression changes (Saito et al. 2002; Ostler et al. 2007) because cell division is required for de novo methylation of CpG islands (Velicescu et al. 2002). These changes caused by the overexpression of DNMT3B4 and DNMT3B7 should be related to cell cycles.
Inhibition of DNMTs in cultured cells and normal human fibroblasts induced the expression of p21, a cyclin-dependent kinase (Cdk) inhibitor, which is critical for cells to enter replicative senescence (Young and Smith 2001; Oridate and Lotan 2005). Although change in the p21 expression did not depend on its promoter DNA methylation (Milutinovic et al. 2000), theremust be some mechanisms associated with modest upregulation of p21 transcripts, in response to DNMTs silencing. This research studied the effect of two kinds of DNMT3b variants without methyltransferase activity on the proliferation.Theroleofp21wasalsoexploredinthisstudyalso.

Materials and Methods

Materials. HCT116 and 293A cell lines were obtained from the China Center for Type Culture Collection (Shanghai, China). RNaeasy mini kit was purchased from Qiagen (Valencia, CA, USA). Superscript III, Dulbecco’s modified Eagle’s medium (DMEM), and fetal bovine serum (FBS) were purchased from Invitrogen (Grand Island, NY, USA). Expand High Fidelity PCR System, Fugene HD transfection reagent, and polyvinylidene difluoride membrane were purchased from Roche (Indianapolis, IN, USA). G418, 3-(4,5dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) and PI were purchased from Sigma (St. Louis, MO, USA). Enhanced chemiluminescence assay kit was purchased from Pierce (Rockford, IL, USA). Rabbit anti-DNMT3B antibody was purchased from Novus (Littleton, CO, USA). The horseradish peroxidase-conjugated antirabbit secondary antibody was acquired from Santa Cruz (Santa Cruz, CA, USA). EZ DNA Methylation-Gold™ Kit was purchased from Zymo Research (Orange, CA, USA).
Cell culture. HCT116and 293A cells were cultured inDMEM supplemented with 10% FBS, 100 U/ml penicillin, and 50 μg/μlstreptomycinat37°Cunder5%CO2 inhumidified air.
Construction of plasmid and generation of stably transfected cell lines. Total RNA was isolated from human cell HCT116 with RNaeasy mini kit and the full-length complementary DNA (cDNA) of DNMT3B4 and DNMT3B7 was amplified with Expand High Fidelity PCR System. The primers were 5′-CG GGA TCC AAG GGA GAC ACC AGG CAT CTC -3′(forward for DNMT3B7 and DNMT3B4); 5′- GC GAATTC GCTATGCCTGGGTACCAGC -3′ (reverse for DNMT3B7); 5′- GC GAATTC CTG TTC ATC CCG GGT AGG TTG -3′(reverse for DNMT3B4), which contained the BamHI and EcoRIrestriction site (underlined), respectively. PCR products were sequenced and then cloned into pCMV-2B vector through BamHI and EcoRI restriction sites to obtain recombinant pCMV-DNMT3B4 and pCMV-DNMT3B7 plasmids. Transfection of 293A cells with pCMV-2B, pCMVDNMT3B4 and pCMV-DNMT3B7 plasmids was performed using Fugene HD transfection reagent according to the manufacturer’s instruction in 35-mm dish. After transfection, cells were incubated with 0.7 mg/ml of G418 for 1 wk in a 35-mm dish and 1 wk in a 100-mm dish. Then, single colony cells were seeded into a 96-well plate for 2 wk. After that, single colonies of stable transfectants of pCMV-DNMT3B4 and pCMV-DNMT3B7 were collected. Overexpression 293A cell colonies (293A-DNMT3B4 and 293A-DNMT3B7) and vector-transfected mock control clone (293A-PCMV-2B) were screened and further identified by real-time PCR. Two clones expressing higher DNMT3B4 messenger RNA (mRNA) and two clones expressing higher DNMT3B7 mRNA were used in this paper. Stable transfected 293A cells were maintained in the media with 0.35 mg/ml of G418.
Analysis of cell proliferation. Cells (5×103 cells/well) were seeded in 96-well plates. MTT assay was used to detect cell proliferation for four consecutive days. In brief, MTT was added to the culture medium with a final MTT concentration of 0.5 mg/ml, and the incubation was continued for 3 h at 37°C. The cell lysates were dissolved with 150 μl dimethyl sulfoxide at room temperature for 10 min. Results were obtained by measuring the absorbance at a wavelength of 490 nm. The test was repeated three times.
Analysis of cell cycle. Cells were cultured in six-well plates and allowed to grow to 75–80% confluency. Cells were then suspended with phosphate-buffered saline (PBS), collected and washed twice with PBS. Cell pellets were resuspended in 0.5 ml of PBS and fixed in 4.5 ml of 70% ethanol overnight. Cells were collected by centrifugation, and the pellets were resuspended in 0.2 mg/ml of propidium iodide (PI) containing 0.1% Triton X-100 and 0.1 mg/ml RNase A, followed by incubation in the dark for 30 min at room temperature and subsequent analysis on FACScan flow cytometer for DNA content. The percentage of cells in different phases of the cell cycle was sorted using a ModFit3.0 computer program.
Real-time PCR. Total RNA was extracted from the transfected and control cells using RNaeasy mini kit. The cDNA was synthesized using Invitrogen Superscript III. The primers of DNMT3B were 5-AGGGAAGACTCGATCC TCGTC-3 (forward) and 5- GTGTGTAGCTTAGCAG ACTGG-3 (reverse). The primers of p21 were 5-TGTCC GTCAGAACCCATGC-3 (forward) and 5-AAAGTCGA AGTTCCATCGCTC3 (reverse). The primers of β-actin (an internal control) were 5-AGGTGAAGGTCGGAGTCA-3 (forward) and 5- GGTCATTGATGGCAACAA -3 (reverse). PCR reactions were carried out on the ABI-7900 real-time PCR machine as follows: initial denaturation at 95°C for 10 min, 40 cycles of 95°C for 30 s, 60°C for 60 s, and a final extension for 2 min at 60°C in a 50-μl reaction mixture containing 2 μl each cDNA, 0.2 μM each primer, and 25 μl 2× real-time master mix. 
Western blot. To prepare whole cell extracts, cells at 90% confluency were washed in PBS before incubation with RIPA buffer (Beyotime Institute of Biotechnology) on ice for 10 min. The protein concentrations were determined using the bicinchoninic acid method. Total cell lysate (40 μg) was separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (12%) at 30 mA for 2.5 h and then blotted onto a nitrocellulose membrane. The membrane was then incubated for 1 h inblocking buffer (Tris-buffered saline containing 10% skimmed milk powder) at room temperature. Next, the membrane was incubated for 16 h at 4°C with the primary antibodies, followed by incubation with secondary antibodies for 1 h at room temperature. After each incubation, the membrane was washed three times thoroughly with Tris-buffered saline containing 0.05% Tween 20. Protein signals were detected by an electrochemiluminescence detection system (Pierce Biotechnology, Rockford, IL), in which the membrane was exposed to the detection solution for 5 min.
Methylation-specific polymerase chain reaction. DNA was extracted from cells, which transfected with DNMT3B4, DNMT3B7, or vector using the Genomic DNA Purification Kit (KWgene Corp). Using the EZ DNA Methylation-Gold™ Kit(Zymo research), 2 μg genomic DNA was converted. Methylation-specific PCR (MS-PCR) for p21 promoter methylation was performed as described previously (Staalesen et al. 2004). Each sample was amplified with two sets of primers for methylated DNA (methylated MS-PCR) and unmethylated DNA (unmethylated MS-PCR), respectively. The primers used for the methylated and unmethylated p21 gene promoter regions were the following: p21-MF, TACGCGAGGTTTCGG GATCG; p21-M R, AAAACGACCCGCGCTCG; p21-UM F,TATGTGAGGTTTTGGGATTGG; and p21-M R,AAAAACAACCCACACTCAACC (Zhang et al. 2009). Then, 100ngofbisulfite-treatedDNAwassubjectedtoamplificationin a total volume of 20 μl containing 10 μl 2× PCR mix (Takara) and a pair of specific primers (0.2 μmol/l). The PCR temperature for methylated-P21 and unmethylated-p21 were as follows: 95°C for 10 min; then cycled at 95°C for 60s, 61°C for 60 s, and 72°C for 60 s, total 35 cycles, followed by a final extension period at 72°C for 5 min. Nine microliters of the PCR products was separated by 2.0% agarose gel electrophoresis and stained with ethidium bromide. Reverser transcription PCR products were 133 bp for both methylated-P21 and unmethylated-p21 (Zhang et al. 2009).
Quantification and statistics. The optical density (OD) of bands of Western blot was obtained by the Gel-Doc system and analyzed with SigmaGel software (Jandel Scientific, San Rafael, CA). The data of the Western blot were normalized to β-actin and presented as relative abundance. The threshold cycle number (CT) value for target genes were normalized against β-actin reference genes and calculated as ΔCT=CTtarget −CTβ-actin. Relative target gene mRNA concentrations were expressed as multiples of its verses reference: F=2ΔCT. All data are expressed as mean±SD (standard deviation). Statistical analysis was performed with an analysis of variance (ANOVA) model for among group factor comparisons, and the Tukey’s honestly significant difference test was used for between group comparisons. All analysis was undertaken using SPSS Version 10.0 ® software (SPSS Inc., Chicago, IL), and p<0.05 was considered to be statistically significant.

Results

Stable transfection of DNMT3B4 and DNMT3B7 cDNAs increased the expression of DNMT3B4 and DNMT 3B7 at both gene and protein level. After transfecting the 293A cells with pCMV-DNMT3B4, pCMV-DNMT3B7, and pCMV-2B plasmids, two stable overexpression cell colonies (293ADNMT3B4, 293A-DNMT3B7) and one vector trans mock control cell colony (293A-vector) were screened and selected. Real-time PCR was used to analyze the expression of DNMT3B4 and DNMT3B7 mRNA. Results showed that the expression of DNMT3B4 gene increased about 78- and 60-fold in 293A-DNMT3B4-1 and 293A-DNMT3B4-2 cells in comparison with that of 293A-vector mock control cells. The expression of DNMT3B7 gene increased about 38- and 33-fold in 293A-DNMT3B7-1 and 293A-DNMT3B7-2 cells in comparison with that of 293A-vector mock control cells (Fig. 1A, p<0.01). The expression of DNMT3B4 and DNMT3B7 protein was also increased as detected by Western blot (Fig. 1B).
DNMT3B4 and DNMT3B7 overexpression decreased cell proliferation. DNMT3B4 and DNMT3B7 overexpression significantly decreased cell proliferation after 3 d in culture as examined by MTT assay (Fig. 2). The proliferation rate in DNMT3B4-1 and DNMT3B4-2 clone was 58.92% and 68.82%, respectively (Fig. 2A, p<0.01), while proliferation rates in DNMT3B7-1 and DNMT3B7-2 clone were 48.83% and 58.49 as compared to 293A-vector cells on day 4 (Fig. 2B, p<0.01).
The effects of DNMT3B4 and DNMT3B7overexpression on the cell cycle progress. The effects of DNMT3B4 and DNMT3B7 overexpression on cell proliferation were further determined by cell cycle progression analysis. Flow cytometry with PI-stained cells showed that 293A-vector control cells were present in G0/G1 (47.94±1.12%), S (40.44%±0.91) and G2/M (11.63%±0.21) phases. While inDNMT3B4-1 and DNMT3B42 clone cells, the S phase fraction was decreased (35.88±2.00% and 37.00±1.79%, respectively), and in DNMT3B7-1 and DNMT3B7-2 clone cells, the S phase fraction was decreased, too (36.84±1.33% and 37.81±1.39%respectively). The changes of G0/G1 fraction and G2 fraction were large among vector, DNMT3B4 and DNMT3B7 cell clones. The results showed that overexpression of DNMT3B4 and DNMT3B7 could decrease S phase fraction (Fig. 3).
The effects of DNMT3B4 and DNMT3B7 overexpression on the expression of p21. The p21 mRNA level was analyzed by real-time PCR in each cell clone. The relative abundance value of p21 mRNA was calculated by examining the ratio of p21 mRNA to β-actin mRNA. Compared with p21 mRNA relative abundance values in 293A-vector (0.062±0.009), the p21 relative abundance values in DNMT3B4-1 (0.42±0.14) and DNMT3B4-2(0.40±0.11) clone were increased 6.77- and 6.45-fold, and the P21 mRNA relative abundance values in DNMT3B7-1(0.26±0.08) and DNMT3B7-2(0.22±0.06) clone were increased 4.19- and 3.54-fold. DNMT3B4 and DNMT3B7 overexpression significantly increased the p21 mRNA (p<0.05, Fig 4A).
p21 protein was detected in each cell clone by Western blot using a goat polyclonal antibody (Fig. 4B). Bands approximately the size of 21 kDa were detected. The relative abundance value of p21 in each cell clone was calculated by the OD ratio of p21 to β-actin. The relative abundance value of p21 in vector was 0.15±0.03. The relative abundance value of p21 protein increased in DNMT3B4-1 and DNMT3B4-2 clone (0.37±0.081 and 0.38±0.087) and increased in DNMT3B7-1 and DNMT3B7-2 clone (0.43±0.09and 0.38±0.038)also (Fig. 4C).p21 protein levels increased more than 2-fold in DNMT3B4- and DNMT3B7overexpressed cell clones.
The effects of DNMT3B4 and DNMT3B7overexpression on DNA methylation of p21promoter. We examined the methylation status of the p21 gene promoters in DNMT3B4- and DNMT3B7-overexpressed 293A cell colonies and vectortransfected mock control, using the MS-PCR technique. As shown by MS-PCR for the methylated or unmethylated p21 gene, both methylated and unmethylated MS-PCR products were 133 bp (Fig. 5). This result demonstrated that p21 gene promoters in vector, DNMT3B4, and DNMT3B7 overexpression 293A cell colonies were methylated. The overexpression of DNMT3B4 and DNMT3B7 did not change the p21 gene promoter methylation pattern.

Discussion

Okano et al. (1998) discovered and cloned human DNMT3B1. At the same time, they also found DNMT3B2 and DNMT3B3 to be produced through alternative splicing. Until now, about 40 DNMT3B variant splices have been reported. They can be divided into three groups mainly by which part of DNMT3B is lacking: (1) DNMT3B3-7 lacked the C-terminal domain of DNMT3B; (2) DNMTΔ3B family lacked the N-terminal domain of DNMT3B (Wang et al. 2006a, b, 2007); and (3) DNMT3BΔ5 and DNMT3BΔ(4+5) lacked some amino acid residues close to PWWP domain of DNMT3B (Gopalakrishnan et al. 2009). Kim et al. (2008) found that the distribution of types of alternative splicing differed between cancerous and normal tissues. DNMT3B4 are major splice variants in hepatocellular carcinoma. The expression of DNMT3B7 alters the process of tumor genesis in Em-Myc/DNMT3B7 mice rather than increasing the susceptible cell population. The DNMTΔ3B family is predominantly expressed in nonsmall cell lung cancer and is associated with RASSF1A promoter methylation (Wang et al. 2006a, b, 2007).
Overexpression of DNMT3B variants can change the proliferation of cells. Overexpression of DNMT3B3Δ5 enhanced cellgrowth inthecolony formationassay and resulted in nearly double the number of colonies compared with empty vector transfected 3BKO cells (Gopalakrishnan et al. 2009). The growth rate of DNMT3B4 transfectants almost doubled that of mock transfectants soon after introduction of DNMT3B4 (Saito et al. 2002; Kanai et al. 2004). In contrast with their data, we found that the proliferation rate in DNMT3B4 clones is about 60–70% when compared to vector cells. Saito et al. (2002) reported that overexpression of DNMT3B4 induced DNA demethylation on pericentromeric satellite regions about 50 d after transfection. They assumed that the allelic imbalance may not yet have accumulated. Therefore, overexpression of DNMT3B4 may facilitate cell cycle progress before allelic imbalance accumulation takes place (Saito et al. 2002). In our research, the cells overexpressing DNMT3B4 were cultured more than 1 yr. Therefore, the effect of overexpression DNMT3B4 on the cell proliferation may have different results at different induction time points. The cell cycle proliferation progress might be inhibited after allelic imbalance accumulation took place. On the other hand, we found that overexpression of DNMT3B7 splice variant inhibited cell proliferation as well. Although different cell lines were used, the results reported here were similar to those obtained by Ostler et al. (2012), who also demonstrated a decreased proliferation ratio of aggressive neuroblastoma cell lines, which overexpressed DNMT3B7. They reasoned that at least some of the gene expression changes were likely to involve changes in DNA methylation of corresponding CpG islands (Ostler et al. 2007).
DNMTs is related to the expression of p21 (Oridate and Lotan 2005; Zheng et al. 2006). For example, Tan and Porter (2009) reported p21 as a novel upstream regulator of DNMT1 expression.p21 belongs to a group of cyclin kinase inhibitors, and it can regulate cell cycle progression. The cyclin kinase inhibitor p21 can induce G1 arrest and block entry into S phase by inactivating Cdks or by inhibiting activity of proliferating cell nuclear antigen (Gartel et al. 1996). Upregulation of p21 limited proliferation (Sperka et al. 2011). In our study, we found that p21 was increased in cells with overexpression of DNMT3B4andDNMT3B7.Ourresultsandotherdataindicated thatchangesinp21expressiondonotdependonthechangeofits promoters’ DNA methylation (Milutinovic et al. 2000). It could explain the increasing genomic instability that caused the overexpression of inactive DNMT3B splice variants. DNMTs inhibition caused growth arrest in normal human fibroblasts by upregulation of the cell cycle inhibitor p21 (Young and Smith 2001), and DNMTs’ inhibition upregulated p21 in DNMTindependent manner via the DNA damage/ATM/p53 axis (Jiemjit et al. 2008). Thus, the mechanism that DNMT3B4 and DNMT3B7 upregulated p21 may be throughp53 and rather than through the changing of p21 promoter methylation. In the future, we will test this mechanism using a p53 gene defect cell line.
Environmental factors, or infections, contributed to the elevated expression of DNMT3B variants, which may be a carcinogenic risk factor (Su et al. 2010). The increase in 3B variants should facilitate cell cycle progression in vivo. Downregulation of p21 is inversely associated with microsatellite instability and CpG island methylator phenotype in colorectal cancer (Ogino et al. 2006). However, the results reported here were different fromthosedataobtained by tissue orinvivo study.We assumed that the levels of DNMT3B4 and DNMT3B7 induced in 293A cell might be too high to carry out their functions similar to those in cancer tissue.
Our findings suggest that forced expression of DNMT3B4 andDNMT3B7 in 293A cells could change the cell proliferation and p21 expression. Because the changes in the DNA methylation of p21 promoter cannot be detected by MS-PCR, there should be one or more molecules that can regulate p21 expression and whose promoter methylation can be changed by DNMT3B4 andDNMT3B7.

References

Gartel A. L.; Serfas M. S.; Tyner A. L. p21—negative regulator of the cell cycle. Proc. Soc. Exp. Biol. Med. 213: 138–149; 1996.
Gopalakrishnan S.; Van Emburgh B. O.; Shan J.; Su Z.; Fields C. R.; Vieweg J.; Hamazaki T.; Schwartz P. H.; Terada N.; Robertson K. D. A novel DNMT3B splice variant expressed in tumor and pluripotent cells modulates genomic DNA methylation patterns and displays altered DNA binding. Mol. Cancer Res. 7: 1622–1634; 2009.
Jiemjit A.; Fandy T. E.; Carraway H.; Bailey K. A.; Baylin S.; Herman J. G.; Gore S. D. p21(WAF1/CIP1) induction by 5-azacytosine nucleosides requires DNA damage. Oncogene 27: 3615–3623; 2008.
Kanai Y.; Saito Y.; Ushijima S.; Hirohashi S. Alterations in gene expression associated with the overexpression of a splice variant of DNA methyltransferase 3b, DNMT3b4, during human hepatocarcinogenesis. J. Cancer Res. Clin. Oncol. 130: 636–644; 2004.
Kim E.; Goren A.; Ast G. Insights into the connection between cancer and alternative splicing. Trends Genet. 24: 7–10; 2008.
Kumar S.; Cheng X.; Klimasauskas S.; Mi S.; Posfai J.; Roberts R. J.; Wilson G. G. The DNA (cytosine-5) methyltransferases. Nucleic Acids Res. 22: 1–10; 1994.
Milutinovic S.; Knox J. D.; Szyf M. DNA methyltransferase inhibition induces the transcription of the tumor suppressor p21(WAF1/CIP1/ sdi1). J. Biol. Chem. 275: 6353–6359; 2000.
Ogino S.; Kawasaki T.; Kirkner G. J.; Ogawa A.; Dorfman I.; Loda M.; Fuchs C. S. Down-regulation of p21 (CDKN1A/CIP1) is inversely associated with microsatellite instability and CpG island methylator phenotype (CIMP) in colorectal cancer. J. Pathol. 210: 147–154; 2006.
Okano M.; Xie S.; Li E. Cloning and characterization of a family of novel mammalian DNA (cytosine-5) methyltransferases. Nat. Genet. 19: 219–220; 1998.
Oridate N.; Lotan R. Suppression of DNA methyltransferase 1 levels in head and neck squamous carcinoma cells using small interfering RNA results in growth inhibition and increase in Cdk inhibitor p21. Int. J. Oncol. 26: 757–761; 2005.
Ostler K. R.; Davis E. M.; Payne S. L.; Gosalia B. B.; ExpositoCespedes J.; Le Beau M. M.; Godley L. A. Cancer cells express aberrant DNMT3B transcripts encoding truncated proteins. Oncogene 26: 5553–5563; 2007.
Ostler, K. R.; Yang, Q.; Looney, T. J.; Zhang, L.; Vasanthakumar, A.; Tian, Y.; Kocherginsky, M.; Raimondi, S. L.; Demaio, J. G.; Salwen, H. R.; Gu, S.; Chlenski, A.; Naranjo, A.; Gill, A.; Peddinti, R.; Lahn, B. T.; Cohn, S. L.; Godley, L. A. Truncated DNMT3B isoform DNMT3B7 suppresses growth, induces differentiation and alters DNA methylation in human neuroblastoma. Cancer Res. 72: 4714–4723; 2012.
Robertson K. D.; Uzvolgyi E.; Liang G.; Talmadge C.; Sumegi J.; Gonzales F. A.; Jones P. A. The human DNA methyltransferases (DNMTs) 1, 3a and 3b: coordinate mRNA expression in normal tissues and overexpression in tumors. Nucleic Acids Res. 27: 2291–2298; 1999.
Saito Y.; Kanai Y.; Sakamoto M.; Saito H.; Ishii H.; Hirohashi S. Overexpression of a splice variant of DNA methyltransferase 3b, DNMT3b4, associated with DNA hypomethylation on pericentromeric satellite regions during human hepatocarcinogenesis. Proc. Natl. Acad. Sci. U. S. A. 99: 10060–10065; 2002.
Shah M. Y.; Vasanthakumar A.; Barnes N. Y.; Figueroa M. E.; Kamp A.; Hendrick C.; Ostler K. R.; Davis E. M.; Lin S.; Anastasi J.; Le Beau M. M.; Moskowitz I. P.; Melnick A.; Pytel P.; Godley L. A. DNMT3B7, a truncated DNMT3B isoform expressed in human tumors, disrupts embryonic development and accelerates lymphomagenesis. Cancer Res. 70: 5840–5850; 2010.
Shen L.; Gao G.; Zhang Y.; Zhang H.; Ye Z.; Huang S.; Huang J.; Kang J. A single amino acid substitution confers enhanced methylation activity of mammalian Dnmt3b on chromatin DNA. Nucleic Acids Res. 38: 6054–6064; 2010.
Sperka T.; Song Z.; Morita Y.; Nalapareddy K.; Guachalla L. M.; Lechel A.; Begus-Nahrmann Y.; Burkhalter M. D.; Mach M.; Schlaudraff F.; Liss B.; Ju Z.; Speicher M. R.; Rudolph K. L. Puma and p21 represent cooperating checkpoints limiting selfrenewal and chromosomal instability of somatic stem cells in response to telomere dysfunction. Nat. Cell Biol. 14: 73–79; 2011.
Staalesen V.; Leirvaag B.; Lillehaug J. R.; Lonning P. E. Genetic and epigenetic changes in p21 and p21B do not correlate with resistance to doxorubicin or mitomycin and 5-fluorouracil in locally advanced breast cancer. Clin. Cancer Res. 10: 3438–3443; 2004.
Su X.; Lv C.; Qiao F.; Qiu X.; Huang W.; Wu Q.; Zhao Z.; Fan H. ExpressionpatternandclinicalsignificanceofDNAmethyltransferase 3B variants in gastric carcinoma. Oncol. Rep. 23: 819–826; 2010.
Tan H. H.; Porter A. G. p21(WAF1) negatively regulates DNMT1 expression in mammalian cells. Biochem. Biophys. Res. Commun. 382: 171–176; 2009.
Velicescu M.; Weisenberger D. J.; Gonzales F. A.; Tsai Y. C.; Nguyen C. T.; Jones P. A. Cell division is required for de novo methylation of CpG islands in bladder cancer cells. Cancer Res. 62: 2378– 2384; 2002.
Wang J.; Bhutani M.; Pathak A. K.; Lang W.; Ren H.; Jelinek J.; He R.; Shen L.; Issa J. P.; Mao L. Delta DNMT3B variants regulate DNA methylation in a promoter-specific manner. Cancer Res. 67: 10647– 10652; 2007.
Wang J.; Walsh G.; Liu D. D.; Lee J. J.; Mao L. Expression of Delta DNMT3B G418 variants and its association with promoter methylation of p16 and RASSF1Ain primary non-small cell lungcancer. Cancer Res. 66: 8361–8366; 2006a.
Wang L.; Wang J.; Sun S.; Rodriguez M.; Yue P.; Jang S. J.; Mao L. A novel DNMT3B subfamily, DeltaDNMT3B, is the predominant form of DNMT3B in non-small cell lung cancer. Int. J. Oncol. 29: 201–207; 2006b.
Young J. I.; Smith J. R. DNA methyltransferase inhibition in normal human fibroblasts induces a p21-dependent cell cycle withdrawal. J. Biol. Chem. 276: 19610–19616; 2001.
Zhang K.; Zhang R.; Li X.; Yin G.; Niu X. Promoter methylation status of p15 and p21 genes in HPP-CFCs of bone marrow of patients with psoriasis. Eur. J. Dermatol. 19: 141–146; 2009.
Zheng Q. H.; Ma L. W.; Zhu W. G.; Zhang Z. Y.; Tong T. J. p21Waf1/ Cip1 plays a critical role in modulating senescence through changes of DNA methylation. J. Cell. Biochem. 98: 1230–1248; 2006.